Next Article in Journal
Bioecological Parameters of the Black Fig Fly, Silba adipata (Diptera: Lonchaeidae), Collected from Fig Crops in Mexico
Previous Article in Journal
Exploring the Biology of Quasi-Social Idiobiont Parasitoids in the Genus Sclerodermus (Hymenoptera: Bethylidae)
Previous Article in Special Issue
Chlorantraniliprole Enhances Cellular Immunity in Larvae of Spodoptera frugiperda (Smith) (Lepidoptera: Noctuidae)
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Insects
Volume 15
Issue 11
10.3390/insects15110882
insects-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Immunomodulation and Protective Effects of Cordyceps militaris Extract Against Candida albicans Infection in Galleria mellonella Larvae

by
Kiratiya Eiamthaworn
1,
David Holthaus
2,3,
Sureeporn Suriyaprom
1,4,
Volker Rickerts
3 and
Yingmanee Tragoolpua
1,5,*
1
Department of Biology, Faculty of Science, Chiang Mai University, Chiang Mai 50200, Thailand
2
Department of Gynecology and Obstetrics, Universitätsklinikum Schleswig-Holstein, 24105 Kiel, Germany
3
Robert Koch Institute, 13353 Berlin, Germany
4
Office of Research Administration, Chiang Mai University, Chiang Mai 50200, Thailand
5
Natural Extracts and Innovative Products for Alternative Healthcare Research Group, Chiang Mai University, Chiang Mai 50200, Thailand
*
Author to whom correspondence should be addressed.
Insects 2024, 15(11), 882; https://doi.org/10.3390/insects15110882
Submission received: 10 September 2024 / Revised: 3 November 2024 / Accepted: 6 November 2024 / Published: 10 November 2024
(This article belongs to the Special Issue Research on Insect Interactions with Symbionts and Pathogens)
Browse Figures
Versions Notes

Simple Summary

Candida albicans can cause common mucosal and severe systemic infections, especially in immunocompromised patients. Current usage of antifungal drugs often leads to side effects and the development of drug-resistant strains. Cordyceps militaris, a parasitic fungus with various medicinal properties, is known for its immunomodulatory role. This study addresses the need for effective treatments against C. albicans infections by analyzing the inhibitory effects of C. militaris aqueous extract on C. albicans and its impact on the immune response in larvae of the greater wax moth Galleria mellonella. C. militaris extract, at nontoxic concentrations, significantly prolonged the survival of larvae infected with a sublethal dose of C. albicans. Additionally, the extract boosted the immune response by increasing hemocyte count and upregulating genes responsible for producing antimicrobial peptides. These findings suggest that C. militaris extract can effectively modulate the immune system and provide protection against fungal infections. This research highlights the potential of C. militaris as a natural, safe, and effective treatment option for C. albicans infections. Therefore, the aqueous extract of C. militaris is contributing to the development of alternative medicines. In addition, the utilization of G. mellonella larvae in this study can reduce the reliance on mammalian models in medical research, benefiting both human health and scientific research.

Abstract

Cordyceps militaris-derived formulations are currently used for multiple purposes because of their medical properties, especially immune system modulation. This study analyzes the inhibitory effects of C. militaris aqueous extract on Candida albicans infections and the immune response in larvae of the greater wax moth Galleria mellonella (Lepidoptera: Pyralidae). Larvae exhibited melanization within 1 h of being infected with C. albicans inoculum at a concentration of 106 cells/larvae, and died within 24 h from a lethal dose. Aqueous extract of C. militaris proved to be nontoxic at concentrations of 0.25 and 0.125 mg/larvae, and had the greatest ability to prolong the survival of larvae infected with a sublethal dose of C. albicans at a concentration of 105 cells/larvae. Moreover, the number of hemocytes in the hemolymph of G. mellonella increased after infection with C. albicans and treatment with the aqueous extract of C. militaris at 1, 24, and 48 h by 1.21 × 107, 1.23 × 107, and 1.4 × 107 cells/100 µL, respectively. The highest number of hemocytes was recorded after treatment of infected G. mellonella with the extract for 48 h. Transcriptional upregulation of the immune system was observed in certain antimicrobial peptides (AMPs), showing that the relative expression of galiomicin, gallerimycin, and lysozyme genes were upregulated as early as 1 h after infection. Therefore, we conclude that C. militaris aqueous extract can modulate the immune system of G. mellonella and protect against infection from C. albicans.

Graphical Abstract

1. Introduction

The Cordyceps genus is an entomogenous fungus that can infect pupae and larvae of lepidopteron insects [1,2]. It is a well-known ascomycete parasitic fungus [3] and is composed of more than 750 species that are found in Asia, Europe, and North America. C. militaris has been used for multiple purposes due to its medicinal properties known for curing various diseases [3] and can also modulate the immune system [4]. Studies on the use of C. militaris for pharmaceutical purposes are shifting to incorporate natural treatments, further fueling the green pharmacy revolution and creating safe and affordable treatment options [5]. The aqueous extract of C. militaris comprises several bioactive substances, such as cordycepin (3′-deoxyadenosine), polysaccharides, ergothioneine, and γ-aminobutyric acid (GABA). These chemicals confer a broad spectrum of therapeutic activities, including anti-inflammation, immunomodulation, antioxidant, and anticancer activities. According to previous research, the aqueous extracts of C. militaris can stimulate macrophages to release immune cytokines such as IFN-γ, which is important for immune system modulation and may have therapeutic application for treatment of cancer and inflammation [4,6]. Various biological compounds have been found in C. militaris, such as γ-aminobutyric acid (GABA), cordycepin, lovastatin, ergothioneine, cordycepic acid, xanthophylls, carotenoids, ergosterol, and phenolic compounds, e.g., phenolic acids and flavonoids, vitamins, and trace elements, i.e., magnesium, potassium, selenium, and sulfur [7,8,9].
Larvae of the greater wax moth Galleria mellonella (Lepidoptera: Pyralidae) have gained popularity as infection models due to the functional similarities between their immune response after infection and the innate mammalian immune response [10,11,12,13]. G. mellonella can be used to assess the virulence of microbial pathogens that are comparable to those obtained from mammalian systems [14,15]. The innate immunity of G. mellonella exhibits similarities to mammalian innate immunity due to the presence of a cellular component [10,16,17]. Hemolymph compares favorably with mammalian blood as a dynamic tissue and contains immune cells known as hemocytes [17]. Hemocytes in G. mellonella play a role similar to mammalian macrophages and neutrophils, contributing to phagocytosis and clearance of pathogen after infection [18]. Moreover, G. mellonella produces antimicrobial peptides (AMPs) that are akin to those found in mammals, contributing to its capacity to fight infections. These factors, along with its ability to thrive at 37 °C [19], make it a valuable model for studying pathogen–host interactions and virulence mechanisms.
The fat body is the storage site for glycogen, lipids, and proteins, and is essential to metabolize energy. Thus, the fat body contributes to the preservation and mobilization of nutrients as well as the synthesis of proteins. These functions of the fat body are similar to the adipose tissues and the liver in vertebrates. Fat bodies are also the origin of immunological responses to pathogens, hematopoiesis, and several other immune components, such as antibacterial compounds and blood-clotting proteins [20].
At present, the use of G. mellonella is expanding, since this model could replace vertebrate infection models in order to reduce the number of mammals used in research [21]. The larvae of the greater wax moth, G. mellonella, are well accepted as a model for the assessment of microbial pathogen virulence factors and the effectiveness of antimicrobial agents after microbial infection and treatment [22,23]. These larvae have demonstrated the ability to be a proper host of fungi to evaluate the effects of antifungal drugs and new compounds with suspected antifungal properties [24]. Other advantages of the G. mellonella model are the cost efficiency and the simplicity in handling. Additionally, G. mellonella can be cultured at 37 °C without requiring any adaptations to the laboratory. These factors have resulted in an increase in the use of these larvae to study fungal virulence, antifungal drug activity, and alternative medicine [25].
Candida albicans is one of many fungi that causes skin disease that persistently colonizes and invades host tissues. It is also a predominant opportunistic fungal pathogen, leading to cutaneous candidiasis disease [26]. Cutaneous candidiasis can be treated with antifungals and steroid therapy. Antibiotics are an important part of contemporary treatments; however, they are becoming ineffective due to the development of microbial resistance [27]. At least 700,000 people per year, and potentially 10 million people by 2050, are expected to suffer from drug-resistant microorganisms [27]. Thus, drug development from natural substances provides viable alternative therapies for treating microbial infections and inflammation. Natural drugs are considered to be less toxic than synthetic ones, and have few side effects. Nowadays, natural compounds or secondary metabolites from fungi are gaining interest and considered to be antimicrobial agents. As important medicinal fungi, C. militaris has also been tested for its antimicrobial activities [28]. However, its biological activities of C. militaris extract against C. albicans, the stimulation of the immune response in G. mellonella after C. albicans infection, and treatment with the aqueous extract of C. militaris have never been investigated [29]. Therefore, the inhibitory effects of the C. militaris aqueous extract on C. albicans and the immune response in G. mellonella after injection of C. albicans into G. mellonella were determined.

2. Materials and Methods

2.1. Preparation of C. militaris Extract, G. mellonella, and C. albicans

C. militaris fruiting body was obtained from the Mushroom Research and Development Center, Chiang Mai Province, Thailand. The dried fruiting body was ground into a fine powder. The powder was then soaked in sterile, distilled water at a ratio of 100 g of C. militaris powder to 1 L of solvent, kept at 45 °C for 3 h, and shaken every 30 min. The extraction was performed twice. Thereafter, the extract was filtered through filter paper No. 1 (Whatman™, Buckinghamshire, UK), evaporated, and lyophilized (LABCONCO, Kansas City, MO, USA) to obtain a crude extract. The crude extract was dissolved in sterile water before use [30]. The percentage yield was calculated from the dry weight as follows:
P e r c e n t a g e   y i e l d   o f   c r u d e   e x t r a c t % = W e i g h t o f e x t r a c t W e i g h t o f d r y   C .   m i l i t a r i s × 100
In this study, we used the sixth instar larvae (late state) with light-color and the average weight of 263.02 ± 5.08 g without any grey color marker on the cuticle. The weight of G. mellonella larvae used in previous studies typically varies from 230–350 mg depending on their developmental stage, age, and environmental conditions [31]. Twenty larvae were used per each test group. During the experiment, G. mellonella were maintained in Petri dishes containing wood chips at 37 °C in dark conditions [32].
C. albicans SC5314 was grown in 50 mL of yeast peptone dextrose (YPD) broth (Thermo Scientific™, Waltham, MA, USA) at 37 °C and stimulated by shaking at 150 rpm for 15–17 h. The C. albicans cell pellet was harvested by centrifugation at 3000× g at 4 °C for 5 min. The pellets containing the C. albicans cells were then washed three times with 10 mL of 0.85% NaCl solution in sterile distilled water. The inoculum of C. albicans was prepared at 108 cells/mL in 0.85% NaCl and injected into G. mellonella at 5 × 105 cells/10 µL.

2.2. Determination of Toxicity of C. militaris Extract on G. mellonella

The aqueous extract of C. militaris was resuspended in sterile distilled water and filtered through a 0.22 µm Minisart® NML cellulose acetate syringe filter (Sartorius, Göttingen, Germany) to prevent contamination from other microorganisms. Then, the extract of C. militaris was evaluated for toxicity through injection at a volume of 10 µL/larvae on G. mellonella using an Omnican® 0.5 mL insulin syringe U-100 (B. Braun, Melsungen, Germany) for injection, and the survival rate was determined [32].
Before injection of C. militaris extract, larvae were cleaned by swabbing the last proleg region with 70% ethanol. To avoid leaking of hemolymph, the hemolymph was gently removed from the larvae at the last proleg region (the final pair of legs) using a 30-gauge needle. The toxicity was evaluated after 5 doses of injections (0.125, 0.25, 0.5, 1, and 2 mg/larvae, respectively) into each group of larvae and was compared to the control group that did not receive any injections. The larval mortality rate was recorded daily. If an extract did not exhibit toxicity, which is defined as having a larval survival rate above 50% in a group, it was classified as nontoxic and accepted for future investigation.

2.3. Determination of G. mellonella Immune Response After C. albicans Infection

The immune response of G. mellonella after C. albicans infection was determined in 6 groups following injections of C. albicans at concentrations of 104, 105, and 106 cells/larvae. The control groups consisted of heat-inactivated (H/I; 65 °C for 30 min) 106 cells/larvae, 0.85% NaCl, and no treatment, respectively. The heat-inactivated C. albicans was verified by plating of 5 µL of the pathogen on yeast peptone dextrose (YPD) agar (Thermo Scientific™, Waltham, MA, USA) to determine the colony of the inactivated pathogen [33,34].
G. mellonella larvae were weighed 24 h before the experiment and then incubated at 37 °C. The groups of G. mellonella larvae were cleaned with 70% ethanol to prepare for injection. Then, 10 µL of C. albicans was injected into larvae at the last left proleg using an insulin syringe. The larvae were then incubated at 37 °C for 30 min [35,36]. Thereafter, 10 µL of C. militaris extract was inoculated into the larvae on the opposite side of the first inoculation. The infected G. mellonella was transferred to a Petri dish containing wood chips and incubated at 37 °C for the duration of the experiment [37]. The health index was recorded as a reference score using the health index score system of G. mellonella larvae [38]. The health index is categorized as follows: unhealthy (0), partially healthy (0.5), healthy (1), and dead larvae (-). Moreover, the response of G. mellonella to C. albicans infection was assessed by observing cocoon formation and melanization. Cocoon production was classified into three levels: (none) larvae without cocoon, (partial) larvae with partial cocoon, and (full) larvae with full cocoon. Melanization was classified into four levels: (0) black larvae, (1) larvae with black spots on a brown background, (2) larvae exhibiting more than three spots, (3) larvae with fewer than three spots, and (4) control larvae without melanization.

2.4. Hemolymph and Fat Body Collection

G. mellonella larvae were infected with C. albicans and treated with C. militaris extract after 1, 24, and 48 h. Three infected G. mellonella larvae were cleaned by swabbing the last proleg region (the final pair of legs) with 70% ethanol and cut with sterile scissors from the lower part of the body to the top while the larvae were still alive without anesthesia. This last proleg region was chosen to minimize damage and provide access to the hemolymph while reducing the risk of gut infection. The hemolymph from three larvae was carefully aspirated into the syringe using a 30-gauge needle and kept in sterile microcentrifuge tube.
The hemolymph (30 µL/larvae) was added to 10 µL phenylthiourea (5 µg/mL) to prevent melanization. The hemocytes were then counted directly after collection using an improved Neubauer hemocytometer (Marienfeld, Lauda-Königshofen, Germany) under a microscope. After removal of the whole hemolymph, fat body from three larvae was collected at 1 h, 24 h, and 48 h in a collection tube. The fat body was collected after the larvae were surface sterilized with 70% ethanol. An incision was performed along the ventral midline, revealing the internal organs. The adipose tissue, a white membrane lining the body cavity, was meticulously excised from each larvae with forceps and collected in a 1.5 mL tube (Eppendorf, Hamburg, Germany) and resuspended in 700 µL of TRI reagent® (Invitrogen, Waltham, MA, USA) for total RNA extraction, which was performed following the manufacturer’s guidelines. RNA concentrations and purity were determined by measuring the absorbance ratio at 260/280 nm using Infinite® M200 PRO plate reader (Tecan, Männedorf, Switzerland) before gene expression analysis [32]. The experiment was performed in triplicate.

2.5. The Expression of Antimicrobial Peptide Genes of G. mellonella by Quantitative Reverse Transcription Polymerase Chain Reaction (qRT-PCR)

G. mellonella larvae were infected by C. albicans and treated with C. militaris extract as described above. Larval RNA was extracted from the fat body using a Direct-zol-RNA-Microprep kit (Zymogen, R2063, Zymo Research, Irvine, CA, USA) at 1, 24, and 48 h post-infection. Quantity of RNA was measured by an Infinite M200 Pro plate reader (Tecan, Männedorf, Switzerland) at 260/280 nm. To reverse-transcribe the RNA, the High-Capacity RNA-to-cDNA Kit (Applied Biosystems, Waltham, MA, USA) was used with 500 ng per reaction. Quantitative RT-PCR was performed using a system composed of a C1000 cycler and CFX96 head (BioRad, Hercules, CA, USA). The program included an initial 10 min enzyme activation step at 95 °C, followed by 40 cycles of 20 s at 95 °C, 30 s at 60 °C and 20 s at 72 °C. Amplicon specificity was confirmed through melting curve analysis [39]. Relative expression levels of the selected AMPs galiomicin, gallerimycin, and lysozyme (Table 1) were quantified using the ΔΔCT method [40,41], using G. mellonella β-actin as the internal reference gene for RNA loading. To validate the method, the difference between the CT values of each AMPs and β-actin [ΔCT = CT (galiomicin, gallerimycin, or lysozyme)  −  CT (β-actin)] was plotted against the log of 10-fold serial dilutions (100, 10, and 1 ng/µL) of purified RNA samples. The plot of log total RNA input versus ΔCT showed a slope of less than 0.1, indicating that the amplification efficiencies of the two amplicons were approximately equal.

2.6. Statistical Analysis

Statistical analyses were performed using GraphPad Prism 9.5.1 (GraphPad Software, Inc., San Diego, CA, USA). The survival curve was analyzed using the log-rank (Mantel–Cox) test, with a p value of ≤0.05 considered significant. For the statistical analysis of hemocyte count and antimicrobial peptide gene expression, two-way ANOVA (Tukey’s multiple comparison test) was employed. Normality of the data was assessed using the Shapiro–Wilk test, and homoscedasticity was evaluated with Levene’s test to ensure the validity of the ANOVA assumptions.

3. Results

3.1. The Fruiting Body of C. militaris Extraction

The fruiting body of C. militaris was extracted with distilled water, resulting in a brown color of the dried crude extract with the percentage yield of 16.8% and a dark brown color of the aqueous extract after dissolving in sterile distilled water (Figure 1).

3.2. Determination of G. mellonella Survival After Treatment with C. militaris Extract

After treating G. mellonella larvae with C. militaris extract at a concentration of 2 mg/larvae group, the larvae moved slower on day 2 and all larvae died on day 4. By this time, some of the dead larvae turned to a red–brown color on the cuticle (Figure 2 and Tables S1 and S2). The extract of C. militaris at concentrations of 0.25 and 0.125 mg/larvae was able to prevent larvae from forming pupae and producing a cocoon. Importantly, these indicated doses did not exhibit lethal effects compared to the control group, thereby allowing the larvae to remain viable. Additionally, the extract did not have a toxic effect on the larvae, and they remained alive longer than the larvae in other groups until the end of the experiment (log-rank test: p < 0.0001). Based on these results, C. militaris extract at concentrations of 0.25 and 0.125 mg/larvae were selected to study the effects of C. militaris extract on experimental G. mellonella larval candidiasis.

3.3. Determination of G. mellonella Survival After C. albicans Infection

The immune response of G. mellonella after infection with C. albicans was observed in six groups, including 104, 105, and 106 cells/larvae, C. albicans heat-inactivated (H/I) 106 cells/larvae, 0.85% NaCl, and the no-treatment (control) group, respectively. When C. albicans inoculum was injected into the proleg of G. mellonella at a concentration of 106 cells/larvae, the larvae expressed melanization within 1 h after being infected and died within 24 h by 90% and 100% within 48 h (Figure 3 and Tables S3 and S4). As the inoculum of 106 cells/larvae was found to be unsuitable for evaluating the immune response of the G. mellonella larvae, C. albicans at a concentration of 105 cells/larvae was selected for further study.

3.4. Response of G. mellonella After C. albicans Infection by Determination of Cocoon Formation and Melanization

Cocoon production was determined after G. mellonella was infected with C. albicans at concentrations of 104, 105, 106 cells/larvae, C. albicans heat-inactivated (H/I) 106 cells/larvae, 0.85% NaCl, and no-treatment (control) groups (Table 2). The results showed that each group of G. mellonella still produced a cocoon, except for the larvae group that was infected with C. albicans at 106 cells/larvae, which could not produce a cocoon after injection. During the observation period and until the end of the experiment, G. mellonella could produce some part of the cocoon after infection with C. albicans at 105 cells/larvae (Figure 4). Thus, the cocoon formation correlated with the survival result.
Another observation of G. mellonella at 24 h after C. albicans infection was the melanization of the larvae. The results exhibited that G. mellonella infected with 104 cells of the C. albicans/larvae, 0.85% NaCl, and no-treatment (control) group did not show any melanization on G. mellonella cuticle (melanization level of 4), whereas G. mellonella infected with C. albicans at 105 cells/larvae showed a melanization level of 3 (<3 spots on larvae). Moreover, G. mellonella infected with C. albicans heat-inactivated (H/I) exhibited black spots on larvae cuticle, caused by a melanization level of 2 (>3 spots on being larvae). Furthermore, G. mellonella infected with C. albicans at 106 cells/larvae showed a melanization level of 1 and completely black color caused by a melanization level of 0, and the larvae rapidly died (Figure 5 and Figure 6).

3.5. The Therapeutic Effects of C. militaris Extract in G. mellonella Infected with C. albicans

C. militaris extracts at concentrations of 0.125 and 0.25 mg/larvae, which proved to be nontoxic to the survival of larvae, were selected for study. When G. mellonella were injected with C. albicans at a concentration of 5 × 105 cells/larvae and treated with C. militaris extract at a concentration of 0.25 mg/larvae, the larvae exhibited a higher mortality compared to the group infected with only C. albicans. Therefore, C. militaris at a concentration of 0.25 mg/larvae did not show any therapeutic effects on G. mellonella. However, when treated with C. militaris extract at a concentration of 0.125 mg/larvae, G. mellonella larvae exhibited a longer survival time compared to the group infected with C. albicans alone (log-rank test: p < 0.0001). Consequently, the concentration of C. militaris extract at 0.125 mg/larvae was chosen for further investigation of antimicrobial peptide gene expression (Figure 7 and Tables S5 and S6).

3.6. Determination of Hemocytes After Infection from C. albicans

To investigate the immune mechanisms associated with the preventive effects of C. militaris extract against C. albicans infection, the quantity of available hemocytes in the hemolymph of larvae after 1, 24, and 48 h of infection was studied (Figure 8 and Table S7). The hemolymph was collected by cutting the abdomen of the larvae. After G. mellonella was infected by C. albicans and treated with C. militaris extract for 1 and 24 h, a similar number of hemocytes was observed at 1.21 × 107 and 1.23 × 107 cells/100 µL, and the hemocyte count was greater than the no-treatment group, defined as an uninfected control group. Interestingly, the hemocytes of G. mellonella after infection by C. albicans and treated with C. militaris extract for 48 h were slightly greater at 1.40 × 107 cells/100 µL. Thus, the hemocytes of G. mellonella after C. albicans infection and treatment with the extract for 1, 24, and 48 h were significantly higher than other groups, indicating that treatment plays a major role in determining hemocyte levels (two-way ANOVA: p < 0.0001). Interestingly, while treatment significantly influenced hemocyte count, time did not have a significant impact (p = 0.6454), and there was no significant interaction between treatment and time (p = 0.7429), suggesting that the treatment effect remains stable over time. These results suggest that C. militaris extract not only elevates hemocyte levels but also supports the immune response in G. mellonella during C. albicans infection.

3.7. Determination of G. mellonella Immune Response After C. albicans Infection and Treatment with C. militaris Extract

3.7.1. Determination of Galiomicin Gene Expression in the G. mellonella Model

The upregulation of the immune system is demonstrated in G. mellonella during an immunological response to a pathogen. Monitoring the gene expression reveals certain antimicrobial peptides (AMPs). In this study, we aimed to quantify the expression of gene-encoding peptides implicated in immunological responses within the larvae. The immune response of G. mellonella in relation to the activation of the galiomicin gene, a defensin found in G. mellonella, was observed by quantitative reverse transcription polymerase chain reaction (qRT-PCR) to analyze the impact of C. albicans infection, both with and without C. militaris extract treatment, and at specific time intervals of 1, 24, and 48 h. Galiomicin gene expression is significantly influenced by treatment (two-way ANOVA: p < 0.0001), suggesting that treatment plays a primary role in enhancing gene expression. Time does not significantly affect galiomicin expression levels (p = 0.7761), and there is no interaction effect between treatment and time (p = 0.8386), indicating that the treatment effect is consistent across the time points.
Interestingly, the upregulation of the galiomicin gene was observed as early as 1 h after infection, showing a significant 2.57-fold increase in G. mellonella after infection with C. albicans and treated with C. militaris extract. Thus, 1 h after G. mellonella was infected, the maximal regulation of galiomicin gene expression was observed and followed by increases of 1.65-fold and 1.95-fold at 24 and 48 h, respectively. In contrast, the group treated with heat-inactivated (H/I) C. albicans had a reduced effect on galiomicin expression in G. mellonella compared to live C. albicans. There were no significant changes in galiomicin levels in the heat-inactivated group, similar to the observation in the no-treatment group. Additionally, when compared to 0.85% NaCl (Figure 9), the relative expression of the galiomicin gene was consistently high at 1, 24, and 48 h after infection with C. albicans and treated with C. militaris extract.

3.7.2. Determination of Gallerimycin Gene Expression in the G. mellonella Model

The expression of the gallerimycin gene, a defensin-like peptide, is shown in Figure 10 at 1, 24, and 48 h after infection with G. mellonella. The relative expression of the gallerimycin gene in G. mellonella was upregulated by 100%, an early and significant event compared to the C. albicans-infected control group. The gallerimycin gene expression is significantly influenced by treatment (two-way ANOVA: p < 0.0001) and time (p = 0.0065), with no significant interaction between treatment and time (p = 0.0515), indicating a consistent effect of treatment across time points. Upregulation happened within 1 h in the groups that were treated with C. militaris extract, by 3.32-fold, as well as C. albicans-infected G. mellonella with C. militaris treatment, by 3.95-fold. However, the expression of gallerimycin at 24 h showed no significant difference between the groups treated with C. militaris extract and C. albicans-infected G. mellonella with C. militaris treatment, when compared to the C. albicans-infected control group. Additionally, the expression of gallerimycin at 48 h was significantly upregulated by 3.42-fold after infection with C. albicans and treated with C. militaris extract, and the expression was higher than the C. albicans-infected control group (Figure 10). In the group treated with heat-inactivated (H/I) C. albicans, there was a reduced impact on gallerimycin expression in G. mellonella compared to those infected with live C. albicans. Additionally, the levels of gallerimycin in the heat-inactivated group showed no significant differences, resembling the results that were seen in the no-treatment group.

3.7.3. Determination of Lysozyme Gene Expression in the G. mellonella Model

The relative expression of the lysozyme gene in G. mellonella after C. albicans infection and treatment with C. militaris extract was significantly different compared to the C. albicans-infected control group, by 4.4-fold upregulation, when observed as early as 1 h, whereas the expression of the lysozyme gene at 24 h showed no significant difference between the groups treated with C. militaris extract, and C. albicans-infected G. mellonella with C. militaris treatment, compared to the C. albicans-infected control group. Moreover, the maximum regulation of the lysozyme gene was noted to show significant differences at 48 h within the same groups (Figure 11). The expression of the lysozyme gene in G. mellonella after C. albicans infection and treatment with C. militaris extract significantly increased by 6.8-fold. In the group treated with heat-inactivated (H/I) C. albicans, there was a diminished effect on lysozyme expression in G. mellonella when comparing to the group that was infected with live C. albicans. Furthermore, the lysozyme gene levels in the heat-inactivated group did not show significant changes, which was similar to the observations made in the no-treatment group. The treatment factor had a statistically significant impact on lysozyme expression (two-way ANOVA: p < 0.0001), while time as a factor did not significantly affect expression levels (p = 0.3194). Furthermore, no significant interaction was observed between treatment and time (p = 0.2602).

4. Discussion

To our knowledge, this study is the first to utilize the greater wax moth G. mellonella as a model host for investigating the gene expression of selected antimicrobial peptides in fat body and the number of hemocytes following C. albicans infection and treatment with C. militaris aqueous extract. Previous studies have reported the antibacterial, antioxidant, and anti-inflammatory properties of C. militaris extract, demonstrating its effectiveness against skin pathogenic bacteria such as Staphylococcus aureus, Pseudomonas aeruginosa, Cutibacterium acnes, and methicillin-resistant S. aureus (MRSA). Moreover, antioxidant activity was also observed from C. militaris extracts [44].
In this study, water was selected for extraction due to its polar protic nature, which effectively extracts polar components from medicinal herbs. The quality of the crude extract is affected by various factors, such as extraction methods, temperature, duration, and solvent polarity, ensuring nontoxicity and experimental integrity [45].
Moreover, this study has sparked curiosity in host–microbe interactions using insects as models [16]. The G. mellonella model has been successfully used for the study of C. albicans pathogenesis. Infected larvae displayed melanization, turning gray within an hour of infection, leading to complete melanization and mortality within 24 h. The melanization has also been described by Rueda et al. [46] during Candida infections; the phenoloxidase cascade occurs and results in melanization of the larvae. This response has been associated with β-glucans on the cell wall surface. Therefore, the degree of melanization of larvae indicates larval health.
The insects use a combination of cellular and humoral responses to defend themselves from invaders. The demarcation between cellular and humoral immune reactions as two distinct categories is not straightforward. This is because many humoral factors affect hemocyte functions, and hemocytes themselves are an important source of many humoral molecules. There is also a considerable overlap between cellular and humoral immune functions that span from recognition of foreign intruders to clot formation [47]. The humoral immune response involves the production of various antimicrobial peptides (AMPs) that can arrest and kill pathogens that evade the cellular immune response [48]. The AMPs are mostly produced in the fat body, hemocytes, the digestive system, salivary glands, and the reproductive tract of insects [10]. Thus, the infection model is correlated to both the hemolymph and hemocytes of infected larvae. During infection, there is an increase in hemocyte concentration along with the expression of antimicrobial peptide (AMP)-encoding genes [37]. Live C. albicans triggers immune activation that mitigates significant hemocyte loss and stimulates an increased production of hemocytes, leading to stable or even elevated hemocyte counts in response to the infection [49]. Similarly, treatment with C. militaris, known for its immunomodulatory properties, stimulates the innate immune system of G. mellonella [50]. This activation promotes the proliferation and functionality of hemocytes, which are essential for the defense mechanisms in insects. In contrast, the no-treatment group and heat-inactivated (H/I) C. albicans group exhibited a weaker immune response due to the absence of active pathogens. This reduced stimulation may result in increased apoptosis (programmed cell death) of hemocytes [47]. Consequently, in the absence of such immune activation, hemocyte levels decline in these groups.
The hemolymph of G. mellonella contains immune-relevant proteins including lysozymes, which support cellular and humoral responses and influence host–parasite interactions [51]. Antimicrobial activity was proven by treating G. mellonella larvae with C. militaris extract, which increased the survival of G. mellonella larvae against C. albicans infection, where substantial antimicrobial activity was detected in the larval hemolymph. Cordycepin also reduced the mortality rate of larvae infected with C. albicans until the end of the experiment by 72 h. Therefore, cordycepin is recommended to counter unfavorable conditions caused by the host immune system [52]. The transcription of AMP-related genes in response to bacterial lipopolysaccharides has revealed proteins that enhance immunity [53]. This study opens possibilities to investigate changes in gene-encoded antimicrobial peptides that are expressed both before and after treatment. Transcriptional expression profiles of AMP-related genes have been widely used to study the capabilities of larval immune systems that express antimicrobial peptides in response to microorganisms. The best characterized G. mellonella AMPs are gallerimycin, galiomicin, cecropins, cobatoxin, moricins, and gloverins, of which gallerimycin and galiomycin are the most studied AMPs [37]. After C. albicans infection, the expression of antimicrobial peptide (AMP) genes, such as galiomicin, gallerimycin, and lysozyme, was induced. Recently, a study found that cordycepin, a secondary metabolite of C. militaris, can act as an insect immune modulator [54]. However, a high dose of cordycepin can decrease the regulation of antimicrobial peptide genes in the immune system response to fungal infection, resulting in rapid death of the insect host [54].
G. mellonella was injected into the hemocoel in this study, and the AMP genes were expressed in the fat body. Crude extract of C. militaris at nontoxic doses could stimulate an immune response and suddenly upregulate antimicrobial peptide genes that can be observed as early as 1 h after infection. Furthermore, Bergin et al. [55] reported similar findings, with increased expression of gallerimycin and galiomicin between 8 and 24 h after exposure to sublethal doses of C. albicans. These findings aligned with our research, which also showed an early increase in the expression of genes responsible for the production of gallerimycin and galiomicin in G. mellonella after infection with C. albicans and treatment with C. militaris. Furthermore, our study revealed that the group treated with heat-inactivated (H/I) C. albicans exhibited a diminished effect on the expression of antimicrobial peptide (AMP) genes in G. mellonella compared to those infected with live C. albicans. Previous research indicates that the immune response, including AMP production, is significantly reduced when exposed to heat-inactivated pathogens compared to live infections [56]. This suggests that live C. albicans induce a more robust immune activation compared to its heat-inactivated form [57].
Previous studies have documented that gallerimycin and galiomicin are antifungal defensins that synthesize via the Toll receptor (TLR) pathway in response to entomopathogenic fungi infections [58,59]. Lysozyme has both antibacterial and antifungal activity [60]. However, the important aspects of the humoral response, such as clotting, ROS generation, and primary immunization of G. mellonella larvae in response to C. albicans infection and treatment with C. militaris extract, have not been studied. These factors are important for a better understanding of G. mellonella as a model organism for studying host–pathogen interactions and infection treatments.
It is possible that the extracts from C. militaris and other entomopathogenic fungi, such as Beauveria bassiana, influence the immune system of G. mellonella, as these extracts could upregulate the expression of important antimicrobial peptide genes [54]. Interestingly, in a previous study, the AMP and galiomicin genes were not upregulated when C. militaris fungi were infected in G. mellonella. It might be due to the route of infection, and the expression of the AMP gene may be found throughout the insect tissue rather than just in the fat body [59]. In our study, however, C. militaris extract enhanced the immune response during C. albicans infection of G. mellonella by recruiting hemocytes and increasing the expression of antimicrobial peptides, including galiomicin, gallerimycin, and lysozyme. These peptides play a crucial role in pathogen defense by disrupting the integrity of the fungal cell wall or membrane [61], similar to other antimicrobial mechanisms observed in invertebrate immune systems. Additionally, the heightened melanization response could encapsulate and neutralize C. albicans cells, preventing further proliferation [62]. Compounds in C. militaris, such as cordycepin, possess antimicrobial, antioxidant, and immune-modulating properties. These compounds potentially enhance pathogen clearance by stimulating phagocytosis and boosting hemocyte activity [63]. This cascade of immune responses strengthens the host’s ability to combat fungal infections. While more research is needed to clarify the precise molecular targets of C. militaris extract within C. albicans, this proposed mechanism underscores the multifaceted role of the extract in immune stimulation.
To date, most research on cordycepin has focused on innate mammalian responses rather than the insect immune system [64,65]. Similarities exist between mammalian and insect immunity, including the homology between the Toll-like receptor in mammals and the Toll receptor in insects, as well as phagocytosis and clotting cascades against invasive pathogens [14]. Therefore, our research may support the use of C. militaris extract for immunomodulation in the G. mellonella model, which may impact treatment of the insects and mammals during C. albicans infections.

5. Conclusions

In this study, the immune response of G. mellonella larvae was examined before and after treatment with C. militaris extract in the context of C. albicans infection. We found that C. militaris significantly enhanced the immune response of G. mellonella, as demonstrated by increased hemocyte recruitment and upregulation of antimicrobial peptide gene expression, including galiomicin, gallerimycin, and lysozyme. These genes were upregulated to maximum levels of expression within 1 h, suggesting rapid immunomodulation. However, while these findings demonstrate the potential of C. militaris extract to modulate the immune system and offer protection against C. albicans, the inherent differences between insect and mammalian immune systems pose challenges when translating these results to human applications. Despite these limitations for the use of G. mellonella, as the larvae lack organs and an adaptive immune system, the use of the larvae is convenient and cost effective with many applications. Further studies are needed to fully elucidate the effects of C. militaris extract in more complex immune systems and to assess long-term implications. Therefore, the G. mellonella model provides valuable insights into potential therapies for C. albicans infections and serves as a foundation for future research.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/insects15110882/s1, Table S1: Weight of G. mellonella larvae in toxicity test of C. militaris extract; Table S2: Survival of G. mellonella larvae after treatment with C. militaris extract; Table S3: Weight of G. mellonella larvae in C. albicans infection; Table S4: Survival of G. mellonella larvae after C. albicans infection; Table S5: Weight of G. mellonella larvae used in the infection of C. albicans at 5 × 105 cells/larvae and treated with C. militaris extract at 0.125 and 0.25 mg/larvae; Table S6: Survival of of G. mellonella larvae after infection with C. albicans at 5 × 105 cells/larvae and treated with C. militaris extract at 0.125 and 0.25 mg/larvae; Table S7: The hemocytes of G. mellonella after C. albicans infection at 5 × 105 cells/larvae and treated with C. militaris extract at 0.125 mg/larvae for 1, 24, and 48 h.

Author Contributions

Conceptualization, K.E. and V.R.; methodology, K.E. and D.H.; validation, K.E., D.H., S.S., V.R., and Y.T.; formal analysis, K.E.; investigation, K.E.; writing—original draft preparation, K.E. and S.S.; writing—review and editing, D.H., S.S., V.R., and Y.T.; supervision, V.R. and Y.T.; funding acquisition, Y.T. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the Research and Researchers for Industrial (RRI) from the National Research Council of Thailand (NRCT); grant number PHD62I0001, the Fundamental Fund, Thailand Science Research and Innovation (TSRI); grant no. FF65/077, and Mushroom Research and Development Center, Chiang Mai, Thailand. This research work was also partially supported by Chiang Mai University, Chiang Mai, Thailand.

Data Availability Statement

The original contributions presented in the study are included in the article/Supplementary Material; further inquiries can be directed to the corresponding author.

Acknowledgments

This research was supported by Natural Extracts and Innovative Products for Alternative Healthcare Research Group and the Department of Biology, Faculty of Science, Chiang Mai University, Chiang Mai, Thailand. The authors are also grateful to Ilka McCormick Smith for her technical support and the Robert Koch Institute, Berlin, Germany.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Pathania, P.; Joshi, M.; Sugar, A. Morphological physiological and molecular studies on wildly collected Cordyceps militaris from North West Himalaya India. Eur. J. Biotechnol. Biosci. 2015, 3, 53–62. [Google Scholar]
  2. Wang, L.; Zhang, W.M.; Hu, B.A.; Chen, Y.Q.; Qu, L.H. Genetic variation of Cordyceps militaris and its allies based on phylogenetic analysis of rDNA ITS sequence data. Fungal Divers 2008, 31, 147–155. [Google Scholar]
  3. Olatunji, J.O.; Tang, J.; Tola, A.; Auberon, F.; Oluwaniyi, O.; Ouyang, Z. The genus Cordyceps: An extensive review of its traditional uses phytochemistry and pharmacology. Fitoterapia 2018, 129, 293–316. [Google Scholar] [CrossRef]
  4. Lee, C.T.; Huang, K.S.; Shaw, J.F.; Chen, J.R.; Kuo, W.S.; Shen, G.; Grumezescu, A.M.; Holban, A.M.; Wang, Y.T.; Wang, J.S.; et al. Trends in the immunomodulatory effects of Cordyceps militaris: Total extracts, polysaccharides and cordycepin. Front. Pharmacol. 2020, 11, 575704. [Google Scholar] [CrossRef]
  5. Das, K.; Tiwari, R.K.S.; Shrivastava, D.K. Techniques for evaluation of medicinal plant products as antimicrobial agent: Current methods and future trends. J. Med. Plant Res. 2010, 4, 104–111. [Google Scholar]
  6. Jędrejko, K.J.; Lazur, J.; Muszyńska, B. Cordyceps militaris: An overview of its chemical constituents in relation to biological activity. Foods 2021, 10, 2634. [Google Scholar] [CrossRef]
  7. Cohen, N.; Cohen, J.; Asatiani, M.D.; Varshney, V.K.; Yu, H.T.; Yang, Y.C.; Li, Y.H.; Mau, J.L.; Wasser, S.P. Chemical composition and nutritional and medicinal value of fruit bodies and submerged cultured mycelia of culinary-medicinal higher basidiomycetes mushrooms. Int. J. Med. Mushrooms 2014, 16, 273–291. [Google Scholar] [CrossRef]
  8. Chen, S.Y.; Ho, K.J.; Hsieh, Y.J.; Wang, L.T.; Mau, J.L. Contents of lovastatin, γ-aminobutyric acid and ergothioneine in mushroom fruiting bodies and mycelia. LWT Food Sci. Technol. 2012, 47, 274–278. [Google Scholar] [CrossRef]
  9. Chan, J.S.L.; Barseghyan, G.S.; Asatiani, M.D.; Wasser, S.P. Chemical composition and medicinal value of fruiting bodies and submerged cultured mycelia of caterpillar medicinal fungus Cordyceps militaris CBS-132098 (Ascomycetes). Int. J. Med. Mushrooms 2015, 17, 649–659. [Google Scholar] [CrossRef]
  10. Tsai, C.J.; Loh, J.M.; Proft, T. Galleria mellonella infection models for the study of bacterial diseases and for antimicrobial drug testing. Virulence 2016, 7, 214–229. [Google Scholar] [CrossRef]
  11. Binder, U.; Maurer, E.; Lass-Flörl, C. Galleria mellonella: An invertebrate model to study pathogenicity in correctly defined fungal species. Fungal Biol. 2016, 120, 288–295. [Google Scholar] [CrossRef]
  12. Wittwer, D.; Franchini, A.; Ottaviani, E.; Wiesner, A. Presence of IL-1- and TNF-like molecules in Galleria mellonella (Lepidoptera) haemocytes and in an insect cell line Fromestigmene acraea (Lepidoptera). Cytokine 1999, 11, 637–642. [Google Scholar] [CrossRef]
  13. Browne, N.; Heelan, M.; Kavanagh, K. An analysis of the structural and functional similarities of insect hemocytes and mammalian phagocytes. Virulence 2013, 4, 597–603. [Google Scholar] [CrossRef]
  14. Sheehan, G.; Garvey, A.; Croke, M.; Kavanagh, K. Innate humoral immune defenses in mammals and insects. Virulence 2018, 9, 1625–1639. [Google Scholar] [CrossRef]
  15. Curtis, A.; Binder, U.; Kavanagh, K. Galleria mellonella larvae as a model for investigating fungal—Host interactions. Front. Fungal Biol. 2022, 3, 18. [Google Scholar] [CrossRef]
  16. Desbois, A.P.; Coote, P.J. Wax moth larva (Galleria mellonella): An in vivo model for assessing the efficacy of antistaphylococcal agents. J. Antimicrob. Chemother. 2011, 66, 1785–1790. [Google Scholar] [CrossRef]
  17. Kavanagh, K.; Reeves, E.P. Exploiting the potential of insects for in vivo pathogenicity testing of microbial pathogens. FEMS Microbiol. Rev. 2004, 28, 101–112. [Google Scholar] [CrossRef]
  18. Ménard, G.; Rouillon, A.; Cattoir, V.; Donnio, P.Y. Galleria mellonella as a suitable model of bacterial infection: Past, present and future. Front. Cell Infect. Microbiol. 2021, 11, 782733. [Google Scholar] [CrossRef]
  19. Dinh, H.; Semenec, L.; Kumar, S.S.; Short, F.L.; Cain, A.K. Microbiology’s next top model: Galleria in the molecular age. FEMS Pathog. Dis. 2021, 79, ftab006. [Google Scholar] [CrossRef]
  20. Azeez, O.I.; Meintjes, R.; Chamunorwa, J.P. Fat body, fat pad and adipose tissues in invertebrates and vertebrates: The nexus. Lipids Health Dis. 2014, 13, 71. [Google Scholar] [CrossRef]
  21. Graham, M.L.; Prescott, M.J. The multifactorial role of the 3Rs in shifting the harm-benefit analysis in animal models of disease. Eur. J. Pharmacol. 2015, 759, 19–29. [Google Scholar] [CrossRef]
  22. Tsai-Stulberg, D.L.; Penrod, M.A.; Blatny, R.A. Common bacterial skin infections. Am. Fam. Physician 2016, 66, 119–125. [Google Scholar]
  23. Cutuli, M.A.; Petronio, G.P.; Vergalito, F.; Magnifico, I.; Pietrangelo, L.; Venditti, N.; Di Marco, R. Galleria mellonella as a consolidated in vivo model host: New developments in antibacterial strategies and novel drug testing. Virulence 2019, 10, 527–541. [Google Scholar] [CrossRef]
  24. Kavanagh, K.; Sheehan, G. The use of Galleria mellonella larvae to identify novel antimicrobial agents against fungal species of medical interest. J. Fungi. 2018, 4, 113. [Google Scholar] [CrossRef]
  25. Brennan, M.; Thomas, D.Y.; Whiteway, M.; Kavanagh, K. Correlation between virulence of Candida albicans mutants in mice and Galleria mellonella larvae. FEMS Immunol. Med. Microbiol. 2002, 34, 153–157. [Google Scholar] [CrossRef]
  26. Kashem, S.W.; Kaplan, D.H. Skin immunity to Candida albicans. Trends Immunol. 2016, 37, 440–450. [Google Scholar] [CrossRef]
  27. Friedrich, M.J. UN: All-out effort needed to combat antimicrobial resistance. JAMA 2019, 321, 2273. [Google Scholar] [CrossRef]
  28. Dong, C.H.; Yang, T.; Lian, T. A comparative study of the antimicrobial, antioxidant, and cytotoxic activities of methanol extracts from fruit bodies and fermented mycelia of caterpillar medicinal mushroom Cordyceps militaris (Ascomycetes). Int. J. Med. Mushrooms 2014, 16, 485–495. [Google Scholar] [CrossRef]
  29. Singh, R.; Singh, A.; Sirohi, S. A review on medicinal and therapeutic potency of Cordyceps militaris. Res. Rev. Biotechnol. Biosci. 2021, 8, 27–33. [Google Scholar]
  30. Song, J.; Wang, Y.; Teng, M.; Zhang, S.; Yin, M.; Lu, J.; Liu, Y.; Lee, J.R.; Wang, D.; Teng, L. Cordyceps militaris induces tumor 459 cell death via the caspase-dependent mitochondrial pathway in HepG2 and MCF-7 cells. Mol. Med. Rep. 2016, 13, 5132–5514. [Google Scholar] [CrossRef]
  31. Mowlds, P.; Kavanagh, K. Effect of pre-incubation temperature on susceptibility of Galleria mellonella larvae to infection by Candida albicans. Mycopathologia 2007, 165, 5–12. [Google Scholar] [CrossRef]
  32. Fuchs, B.B.; O’Brien, E.; El Khoury, J.B.; Mylonakis, E. Methods for using Galleria mellonella as a model host to study fungal pathogenesis. Virulence 2010, 1, 475–482. [Google Scholar] [CrossRef]
  33. Birkenfeld, Z.M.; Dittel, N.; Harrer, T.; Stephan, C.; Kiderlen, A.F.; Rickerts, V. Phenotypic diversity of Cryptococcus neoformans var. neoformans clinical isolates from localized and disseminated infections. Microorganisms 2022, 10, 321. [Google Scholar] [CrossRef]
  34. Thammasit, P.; Tharinjaroen, C.S.; Tragoolpua, Y.; Rickerts, V.; Georgieva, R.; Bäumler, H.; Tragoolpua, K. Targeted propolis-loaded poly (butyl) cyanoacrylate nanoparticles: An alternative drug delivery tool for the treatment of cryptococcal meningitis. Front. Pharmacol 2021, 12, 723727. [Google Scholar] [CrossRef]
  35. Li, D.D.; Deng, L.; Hu, G.H.; Zhao, L.X.; Hu, D.D.; Jiang, Y.Y.; Wang, Y. Using Galleria mellonella–Candida albicans infection model to evaluate antifungal agents. Biol. Pharm. Bull. 2013, 36, 1482–1487. [Google Scholar] [CrossRef]
  36. Vertyporokh, L.; Wojda, I. Immune response of Galleria mellonella after injection with non-lethal and lethal dosages of Candida albicans. J. Invertebr. Pathol. 2020, 170, 107327. [Google Scholar] [CrossRef]
  37. Pereira, T.C.; de Barros, P.P.; Fugisaki, L.; Rossoni, R.D.; Ribeiro, F.C.; de Menezes, R.T.; Junqueira, J.C.; Scorzoni, L. Recent advances in the use of Galleria mellonella model to study immune responses against human pathogens. J. Fungi. 2018, 4, 128. [Google Scholar] [CrossRef]
  38. Loh, J.M.; Adenwalla, N.; Wiles, S.; Proft, T. Galleria mellonella larvae as an infection model for group A Streptococcus. Virulence 2013, 4, 419–428. [Google Scholar] [CrossRef]
  39. Holthaus, D.; Delgado-Betancourt, E.; Aebischer, T.; Seeber, F.; Klotz, C. Harmonization of protocols for multi-species organoid platforms to study the intestinal biology of Toxoplasma gondii and other protozoan infections. Front. Cell Infect. Microbiol. 2021, 10, 935. [Google Scholar] [CrossRef]
  40. Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2− ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
  41. Pfaffl, M.W.; Horgan, G.W.; Dempfle, L. Relative expression software tool (REST©) for group-wise comparison and statistical analysis of relative expression results in real-time PCR. Nucleic Acids Res. 2002, 30, e36. [Google Scholar] [CrossRef] [PubMed]
  42. Ranjith, R.; Elisa, B.; Manica, F.; Federica, P.; Delfena, T.; David, F.L.; Lindsay, O.; Darren, G.; Gordon, R.; Christopher, N. Acetylcholine protects against Candida albicans infection by inhibiting biofilm formation and promoting hemocyte function in a Galleria mellonella infection model. Eukaryot. Cell 2015, 14, 834–844. [Google Scholar]
  43. Lange, A.; Schäfer, A.; Bender, A.; Steimle, A.; Beier, S.; Parusel, R.; Frick, J.S. Galleria mellonella: A novel invertebrate model to distinguish intestinal symbionts from pathobionts. Front. Immunol. 2018, 9, 2114. [Google Scholar] [CrossRef] [PubMed]
  44. Eiamthaworn, K.; Kaewkod, T.; Bovonsombut, S.; Tragoolpua, Y. Efficacy of Cordyceps militaris extracts against some skin pathogenic bacteria and antioxidant activity. J. Fungi 2022, 8, 327. [Google Scholar] [CrossRef] [PubMed]
  45. Tiwari, P.; Kumar, B.; Kaur, M.; Kaur, G.; Kaur, H. Phytochemical screening and extraction: A review. Int. pharm. sci. 2011, 1, 98–106. [Google Scholar]
  46. Rueda, C.; Cuenca-Estrella, M.; Zaragoza, O. Paradoxical growth of Candida albicans in the presence of caspofungin is associated with multiple cell wall rearrangements and decreased virulence. Antimicrob. Agents Chemother. 2014, 58, 1071–1083. [Google Scholar] [CrossRef]
  47. Eleftherianos, I.; Heryanto, C.; Bassal, T.; Zhang, W.; Tettamanti, G.; Mohamed, A. Haemocyte-mediated immunity in insects: Cells, processes and associated components in the fight against pathogens and parasites. Immunolgy 2021, 164, 401–432. [Google Scholar] [CrossRef]
  48. Fallon, J.P.; Troy, N.; Kavanagh, K. Pre-exposure of Galleria mellonella larvae to different doses of Aspergillus fumigatus conidia causes differential activation of cellular and humoral immune responses. Virulence 2011, 2, 413–421. [Google Scholar] [CrossRef]
  49. Trevijano-Contador, N.; Zaragoza, O. Immune response of Galleria mellonella against human fungal pathogens. J. Fungi 2018, 5, 3. [Google Scholar] [CrossRef]
  50. Xu, J.; Xu, D.; Hu, Q.; Ma, N.; Pei, F.; Su, A.; Ma, G. Immune regulatory functions of biologically active proteins from edible fungi. Front. Immunol. 2023, 13, 1034545. [Google Scholar] [CrossRef]
  51. Zdybicka-Barabas, A.; Stączek, S.; Mak, P.; Skrzypiec, K.; Mendyk, E.; Cytryńska, M. Synergistic action of Galleria mellonella apolipophorin III and lysozyme against Gram-negative bacteria. Biochim. Biophys. ActaBiomembr. 2013, 1828, 1449–1456. [Google Scholar] [CrossRef] [PubMed]
  52. Qin, P.; Li, X.; Yang, H.; Wang, Z.Y.; Lu, D. Therapeutic potential and biological applications of cordycepin and metabolic mechanisms in cordycepin-producing fungi. Molecules 2019, 24, 2231. [Google Scholar] [CrossRef] [PubMed]
  53. Vogel, H.; Altincicek, B.; Glöckner, G.; Vilcinskas, A. A comprehensive transcriptome and immune-gene repertoire of the lepidopteran model host Galleria mellonella. BMC Genom. 2011, 12, 308. [Google Scholar] [CrossRef] [PubMed]
  54. Woolley, C.V.; Teakle, R.G.; Prince, G.; de Moor, C.H.; Chandler, D. Cordycepin, a metabolite of Cordyceps militaris, reduces immune-related gene expression in insects. J. Invertebr. Pathol. 2020, 177, 107480. [Google Scholar] [CrossRef] [PubMed]
  55. Bergin, D.; Murphy, L.; Keenan, J.; Clynes, M.; Kavanagh, K. Pre-exposure to yeast protects larvae of Galleria mellonella from a subsequent lethal infection by Candida albicans and is mediated by the increased expression of antimicrobial peptides. Microbes Infect 2006, 8, 2105–2112. [Google Scholar] [CrossRef] [PubMed]
  56. Velikova, N.; Kavanagh, K.; Wells, J.M. Evaluation of Galleria mellonella larvae for studying the virulence of Streptococcus suis. BMC Microbiol. 2016, 16, 291. [Google Scholar] [CrossRef]
  57. Mesa-Arango, A.C.; Forastiero, A.; Bernal-Martínez, L.; Cuenca-Estrella, M.; Mellado, E.; Zaragoza, O. The non-mammalian host Galleria mellonella can be used to study the virulence of the fungal pathogen Candida tropicalis and the efficacy of antifungal drugs during infection by this pathogenic yeast. Med. Mycol. J. 2013, 51, 461–472. [Google Scholar] [CrossRef]
  58. Langen, G.; Imani, J.; Altincicek, B.; Kieseritzky, G.; Kogel, K.H.; Vilcinskas, A. Transgenic expression of gallerimycin, a novel antifungal insect defensin from the greater wax moth Galleria mellonella, confers resistance to pathogenic fungi in tobacco. Biol. Chem. 2006, 387, 549–557. [Google Scholar] [CrossRef]
  59. Vertyporokh, L.; Wojda, I. Expression of the insect metalloproteinase inhibitor IMPI in the fat body of Galleria mellonella exposed to infection with Beauveria bassiana. Acta Biochim. Pol. 2017, 64, 273–278. [Google Scholar] [CrossRef]
  60. Sowa-Jasiłek, A.; Zdybicka-Barabas, A.; Stączek, S.; Wydrych, J.; Skrzypiec, K.; Mak, P.; Deryło, K.; Tchórzewski, M.; Cytryńska, M. Galleria mellonella lysozyme induces apoptotic changes in Candida albicans cells. Microbiol. Res. 2016, 193, 121–131. [Google Scholar] [CrossRef]
  61. Dekkerová-Chupáčová, J.; Borghi, E.; Morace, G.; Bujdáková, H. Up-regulation of antimicrobial peptides gallerimycin and galiomicin in Galleria mellonella infected with Candida yeasts displaying different virulence traits. Mycopathologia 2018, 183, 935–940. [Google Scholar] [CrossRef] [PubMed]
  62. Nakhleh, J.; El Moussawi, L.; Osta, M.A. The melanization response in insect immunity. Adv. Insect Physiol. 2017, 52, 83–109. [Google Scholar]
  63. Zhang, D.; Tang, Q.; He, X.; Wang, Y.; Zhu, G.; Yu, L. Antimicrobial, antioxidant, anti-inflammatory, and cytotoxic activities of Cordyceps militaris spent substrate. PLoS ONE 2023, 18, e0291363. [Google Scholar] [CrossRef]
  64. Ren, Z.; Jianhua, C.; Huo, Z.; Xue, J.; Cui, H.; Luo, B.; Jiang, L.; Yang, R. Cordycepin suppresses TNF-α-induced NF-κB activation by reducing p65 transcriptional activity, inhibiting IκBα phosphorylation, and blocking IKKγ ubiquitination. Int. Immunopharmacol. 2012, 14, 698–703. [Google Scholar] [CrossRef]
  65. Ashraf, S.; Radhi, M.; Gowler, P.; Burston, J.J.; Gandhi, R.D.; Thorn, G.J.; Piccinini, A.M.; Walsh, D.A.; Chapman, V.; De, M.C.H. The polyadenylation inhibitor cordycepin reduces pain, inflammation, and joint pathology in rodent models of osteoarthritis. Sci. Rep. 2019, 9, 4696. [Google Scholar] [CrossRef]
Insects 15 00882 g001
Figure 1. The extraction of C. militaris fruiting body. (A) The fruiting body of C. militaris, (B) the dried crude extract, and (C) the aqueous extract after dissolving in sterile distilled water.
Figure 1. The extraction of C. militaris fruiting body. (A) The fruiting body of C. militaris, (B) the dried crude extract, and (C) the aqueous extract after dissolving in sterile distilled water.
Insects 15 00882 g001
Insects 15 00882 g002
Figure 2. Survival of G. mellonella larvae after treatment with different concentrations of C. militaris extract. Survival rates were determined using the Kaplan–Meier test. (A) No treatment (control), (B) 2 mg/larvae, (C) 1 mg/larvae, (D) 0.50 mg/larvae, (E) 0.25 mg/larvae, (F) 0.125 mg/larvae, and (G) toxicity of C. militaris extract on G. mellonella at 0.125 (grey line), 0.25 (blue line), 0.5 (yellow line), 1 (green line), and 2 mg/larvae (red line). Significant difference was shown when treating with C. militaris extracts at 1 and 2 mg/larvae using log-rank test (χ2 = 128.1, dF = 5, n = 20, and p < 0.0001), and no significant difference was observed between “no-treatment” control and the group treated with C. militaris extracts at 0.125, 0.25, and 0.5 mg/larvae. Kaplan–Meier survival curves were determined from three independent experiments. The superscript letters (a–c) represent statistically significant differences between the Kaplan–Meier survival curves. Curves designated with the same letter are not significantly different from one another.
Figure 2. Survival of G. mellonella larvae after treatment with different concentrations of C. militaris extract. Survival rates were determined using the Kaplan–Meier test. (A) No treatment (control), (B) 2 mg/larvae, (C) 1 mg/larvae, (D) 0.50 mg/larvae, (E) 0.25 mg/larvae, (F) 0.125 mg/larvae, and (G) toxicity of C. militaris extract on G. mellonella at 0.125 (grey line), 0.25 (blue line), 0.5 (yellow line), 1 (green line), and 2 mg/larvae (red line). Significant difference was shown when treating with C. militaris extracts at 1 and 2 mg/larvae using log-rank test (χ2 = 128.1, dF = 5, n = 20, and p < 0.0001), and no significant difference was observed between “no-treatment” control and the group treated with C. militaris extracts at 0.125, 0.25, and 0.5 mg/larvae. Kaplan–Meier survival curves were determined from three independent experiments. The superscript letters (a–c) represent statistically significant differences between the Kaplan–Meier survival curves. Curves designated with the same letter are not significantly different from one another.
Insects 15 00882 g002
Insects 15 00882 g003
Figure 3. Survival of G. mellonella larvae after C. albicans infection. (A) No treatment (control), (B) 0.85% NaCl, (C) C. albicans heat-inactivated (H/I), (D) C. albicans 104 cells/larvae, (E) C. albicans 105 cells/larvae, (F) C. albicans 106 cells/larvae, and (G) survival of G. mellonella after infection with C. albicans at 104 cells/larvae (purple line), 105 cells/larvae (green line), 106 cells/larvae (blue line), 106 heat-inactivated (H/I) cells/larvae (red line), and 0.85% NaCl (yellow line) compared with no treatment (control). There was no significant difference in each group of samples, except 106 cells/larvae, which exhibited a highly significant difference using log-rank test (χ2 = 110.5, dF = 5, n = 20, and p < 0.0001) compared with no treatment (control). Kaplan–Meier survival curves were determined from three independent experiments. The superscript letters (a,b) represent statistically significant differences between the Kaplan–Meier survival curves. Curves designated with the same letter are not significantly different from one another.
Figure 3. Survival of G. mellonella larvae after C. albicans infection. (A) No treatment (control), (B) 0.85% NaCl, (C) C. albicans heat-inactivated (H/I), (D) C. albicans 104 cells/larvae, (E) C. albicans 105 cells/larvae, (F) C. albicans 106 cells/larvae, and (G) survival of G. mellonella after infection with C. albicans at 104 cells/larvae (purple line), 105 cells/larvae (green line), 106 cells/larvae (blue line), 106 heat-inactivated (H/I) cells/larvae (red line), and 0.85% NaCl (yellow line) compared with no treatment (control). There was no significant difference in each group of samples, except 106 cells/larvae, which exhibited a highly significant difference using log-rank test (χ2 = 110.5, dF = 5, n = 20, and p < 0.0001) compared with no treatment (control). Kaplan–Meier survival curves were determined from three independent experiments. The superscript letters (a,b) represent statistically significant differences between the Kaplan–Meier survival curves. Curves designated with the same letter are not significantly different from one another.
Insects 15 00882 g003
Insects 15 00882 g004
Figure 4. Cocoon production of G. mellonella after C. albicans infection for more than 24 h. None is larvae without cocoon, partial is larvae with partial cocoon, and full is larvae with full cocoon.
Figure 4. Cocoon production of G. mellonella after C. albicans infection for more than 24 h. None is larvae without cocoon, partial is larvae with partial cocoon, and full is larvae with full cocoon.
Insects 15 00882 g004
Insects 15 00882 g005
Figure 5. The level of melanization in G. mellonella: (0) black larvae, (1) black spots on brown larvae, (2) >3 spots on being larvae, (3) <3 spots on larvae, and (4) control without melanization.
Figure 5. The level of melanization in G. mellonella: (0) black larvae, (1) black spots on brown larvae, (2) >3 spots on being larvae, (3) <3 spots on larvae, and (4) control without melanization.
Insects 15 00882 g005
Insects 15 00882 g006
Figure 6. The melanization of G. mellonella after 24 h of C. albicans infection. (A) No treatment (control), (B) 0.85% NaCl, (C) C. albicans heat-inactivated (H/I), (D) C. albicans 104 cells/larvae, (E) C. albicans 105 cells/larvae, (F) C. albicans 106 cells/larvae.
Figure 6. The melanization of G. mellonella after 24 h of C. albicans infection. (A) No treatment (control), (B) 0.85% NaCl, (C) C. albicans heat-inactivated (H/I), (D) C. albicans 104 cells/larvae, (E) C. albicans 105 cells/larvae, (F) C. albicans 106 cells/larvae.
Insects 15 00882 g006
Insects 15 00882 g007
Figure 7. Survival of G. mellonella after infection with C. albicans at 5 × 105 cells/larvae and treated with C. militaris extract at 0.125 and 0.25 mg/larvae. The survival of G. mellonella after infection with C. albicans at 5 × 105 cells/larvae was found to be significantly different between the C. militaris treatment groups (0.125 mg/larvae and 0.25 mg/larvae using log-rank test (χ2 = 58.46, dF = 5, n = 20, and p < 0.0001)) when compared to the C. albicans-infected G. mellonella control group. There was no significant difference in the survival of G. mellonella after treatment with 0.85% NaCl or C. militaris extract at 0.125 and 0.25 mg/larvae compared to the no-treatment (control) group. The superscript letters (a–d) represent statistically significant differences between the Kaplan–Meier survival curves. Curves designated with the same letter are not significantly different from one another.
Figure 7. Survival of G. mellonella after infection with C. albicans at 5 × 105 cells/larvae and treated with C. militaris extract at 0.125 and 0.25 mg/larvae. The survival of G. mellonella after infection with C. albicans at 5 × 105 cells/larvae was found to be significantly different between the C. militaris treatment groups (0.125 mg/larvae and 0.25 mg/larvae using log-rank test (χ2 = 58.46, dF = 5, n = 20, and p < 0.0001)) when compared to the C. albicans-infected G. mellonella control group. There was no significant difference in the survival of G. mellonella after treatment with 0.85% NaCl or C. militaris extract at 0.125 and 0.25 mg/larvae compared to the no-treatment (control) group. The superscript letters (a–d) represent statistically significant differences between the Kaplan–Meier survival curves. Curves designated with the same letter are not significantly different from one another.
Insects 15 00882 g007
Insects 15 00882 g008
Figure 8. The increased hemocytes of G. mellonella after C. albicans infection at 5 × 105 cells/larvae and treated with C. militaris extract at 0.125 mg/larvae for 1, 24, and 48 h using two-way ANOVA (Tukey’s multiple comparison test). a, b, c, d, e indicate a significant difference (p < 0.05) compared with the no-treatment group as the untreated cell control. The differences in hemocyte count are significantly influenced by treatment (two-way ANOVA: F(5, 36) = 40.83, dF = 5, n = 3, p < 0.0001). Time does not have a significant impact on hemocyte count (two-way ANOVA: F(2, 36) = 0.4433, dF = 2, n = 3, p = 0.6454), and there is no significant interaction between treatment and time (two-way ANOVA: F(10, 36) = 0.6714, dF = 10, n = 3, p = 0.7429).
Figure 8. The increased hemocytes of G. mellonella after C. albicans infection at 5 × 105 cells/larvae and treated with C. militaris extract at 0.125 mg/larvae for 1, 24, and 48 h using two-way ANOVA (Tukey’s multiple comparison test). a, b, c, d, e indicate a significant difference (p < 0.05) compared with the no-treatment group as the untreated cell control. The differences in hemocyte count are significantly influenced by treatment (two-way ANOVA: F(5, 36) = 40.83, dF = 5, n = 3, p < 0.0001). Time does not have a significant impact on hemocyte count (two-way ANOVA: F(2, 36) = 0.4433, dF = 2, n = 3, p = 0.6454), and there is no significant interaction between treatment and time (two-way ANOVA: F(10, 36) = 0.6714, dF = 10, n = 3, p = 0.7429).
Insects 15 00882 g008
Insects 15 00882 g009
Figure 9. The relative gene expression of galiomicin in G. mellonella was observed by qRT-PCR to analyze the impact of C. albicans infection in G. mellonella after treatment with C. militaris extract at specific time intervals of 1, 24, and 48 h. a, b indicate a significant difference (p < 0.05) compared to the C. albicans-infected control group. Galiomicin gene expression is significantly influenced by treatment (two-way ANOVA: F(5, 36) = 15.60, dF = 5, n = 3, p < 0.0001). Time does not have a significant effect on gene expression levels (two-way ANOVA: F(2, 36) = 0.2552, dF = 2, n = 3, p = 0.7761), and there is no significant interaction between treatment and time (two-way ANOVA: F(10, 36) = 0.5551, dF = 10, n = 3, p = 0.8386).
Figure 9. The relative gene expression of galiomicin in G. mellonella was observed by qRT-PCR to analyze the impact of C. albicans infection in G. mellonella after treatment with C. militaris extract at specific time intervals of 1, 24, and 48 h. a, b indicate a significant difference (p < 0.05) compared to the C. albicans-infected control group. Galiomicin gene expression is significantly influenced by treatment (two-way ANOVA: F(5, 36) = 15.60, dF = 5, n = 3, p < 0.0001). Time does not have a significant effect on gene expression levels (two-way ANOVA: F(2, 36) = 0.2552, dF = 2, n = 3, p = 0.7761), and there is no significant interaction between treatment and time (two-way ANOVA: F(10, 36) = 0.5551, dF = 10, n = 3, p = 0.8386).
Insects 15 00882 g009
Insects 15 00882 g010
Figure 10. The relative gene expression of gallerimycin was observed by qRT-PCR to analyze the impact of C. albicans infection in G. mellonella treated with C. militaris extract at specific time intervals of 1, 24, and 48 h. a, b, c indicate a significant difference (p < 0.05) compared to the C. albicans-infected control group. Gallerimycin gene expression is significantly influenced by both treatment (two-way ANOVA: F(5, 36) = 39.55, dF = 5, n = 3, p < 0.0001) and time (two-way ANOVA: F(2, 36) = 5.813, dF = 2, n = 3, p = 0.0065). There is no significant interaction between treatment and time (two-way ANOVA: F(10, 36) = 2.093, dF = 10, n = 3, p = 0.0515).
Figure 10. The relative gene expression of gallerimycin was observed by qRT-PCR to analyze the impact of C. albicans infection in G. mellonella treated with C. militaris extract at specific time intervals of 1, 24, and 48 h. a, b, c indicate a significant difference (p < 0.05) compared to the C. albicans-infected control group. Gallerimycin gene expression is significantly influenced by both treatment (two-way ANOVA: F(5, 36) = 39.55, dF = 5, n = 3, p < 0.0001) and time (two-way ANOVA: F(2, 36) = 5.813, dF = 2, n = 3, p = 0.0065). There is no significant interaction between treatment and time (two-way ANOVA: F(10, 36) = 2.093, dF = 10, n = 3, p = 0.0515).
Insects 15 00882 g010
Insects 15 00882 g011
Figure 11. The relative gene expression of the lysozyme was observed by qRT-PCR to analyze the impact of C. albicans infection on G. mellonella treated with C. militaris extract at specific time intervals of 1, 24, and 48 h. a, b, c indicate a significant difference (p < 0.05) compared to the C. albicans-infected control group. Lysozyme gene expression is significantly influenced by treatment (two-way ANOVA: F(5, 36) = 13.24, dF = 5, n = 3, p < 0.0001), whereas time does not have a significant effect on expression levels (two-way ANOVA: F(2, 36) = 1.178, dF = 2, n = 3, p = 0.3194), and there is no significant interaction between treatment and time (two-way ANOVA: F(10, 36) = 1.314, dF = 10, n = 3, p = 0.2602).
Figure 11. The relative gene expression of the lysozyme was observed by qRT-PCR to analyze the impact of C. albicans infection on G. mellonella treated with C. militaris extract at specific time intervals of 1, 24, and 48 h. a, b, c indicate a significant difference (p < 0.05) compared to the C. albicans-infected control group. Lysozyme gene expression is significantly influenced by treatment (two-way ANOVA: F(5, 36) = 13.24, dF = 5, n = 3, p < 0.0001), whereas time does not have a significant effect on expression levels (two-way ANOVA: F(2, 36) = 1.178, dF = 2, n = 3, p = 0.3194), and there is no significant interaction between treatment and time (two-way ANOVA: F(10, 36) = 1.314, dF = 10, n = 3, p = 0.2602).
Insects 15 00882 g011
Table 1. Antimicrobial peptide primers used for quantitative reverse transcription polymerase chain reaction (qRT-PCR).
Table 1. Antimicrobial peptide primers used for quantitative reverse transcription polymerase chain reaction (qRT-PCR).
GenesThe Sequence of PCR Primers (5′–3′)References
galiomicinF: CCTCTGATTGCAATGCTGAGTG
R: GCTGCCAAGTTAGTCAACAGG		[42]
gallerimycinF: GAAGATCGCTTTCATAGTCGC
R: TACTCCTGCAGTTAGCAATGC		[42]
lysozymeF: GGACTGGTCCGAGCACTTAG
R: CGCATTTAGAGGCAACCGTG		[43]
β-actinF: GGGACGATATGGAGAAGATCTG
R: CACGCTCTGTGAgvGGATCTTC		[42]
Table 2. The G. mellonella health index score.
Table 2. The G. mellonella health index score.
DayConditions
No Treatment0.85% NaCl 106 H/I106105104
0Injection
1111011
2111011
310.50.5-11
410.50.5-11
50.50.50.5-0.50.5
60.50.50.5-0.50.5
70.50.50.5-0.50.5
Healthy index is indicated as unhealthy (0), partial healthy (0.5), healthy (1), and dead larvae (-).
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Eiamthaworn, K.; Holthaus, D.; Suriyaprom, S.; Rickerts, V.; Tragoolpua, Y. Immunomodulation and Protective Effects of Cordyceps militaris Extract Against Candida albicans Infection in Galleria mellonella Larvae. Insects 2024, 15, 882. https://doi.org/10.3390/insects15110882

AMA Style

Eiamthaworn K, Holthaus D, Suriyaprom S, Rickerts V, Tragoolpua Y. Immunomodulation and Protective Effects of Cordyceps militaris Extract Against Candida albicans Infection in Galleria mellonella Larvae. Insects. 2024; 15(11):882. https://doi.org/10.3390/insects15110882

Chicago/Turabian Style

Eiamthaworn, Kiratiya, David Holthaus, Sureeporn Suriyaprom, Volker Rickerts, and Yingmanee Tragoolpua. 2024. "Immunomodulation and Protective Effects of Cordyceps militaris Extract Against Candida albicans Infection in Galleria mellonella Larvae" Insects 15, no. 11: 882. https://doi.org/10.3390/insects15110882

APA Style

Eiamthaworn, K., Holthaus, D., Suriyaprom, S., Rickerts, V., & Tragoolpua, Y. (2024). Immunomodulation and Protective Effects of Cordyceps militaris Extract Against Candida albicans Infection in Galleria mellonella Larvae. Insects, 15(11), 882. https://doi.org/10.3390/insects15110882

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop